lei lu (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
lei lu
Lei Lu, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lei+lu/pSUPER-retro-puro-shNup35-EcoRI+(Plasmid+%2387332)/pm40411682-372-26-28
Average 93 stars, based on 3 article reviews
Lei Lu, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lei+lu/pSUPER-retro-puro-shNup35-EcoRI+(Plasmid+%2387332)/pm40411682-372-26-28
Average 93 stars, based on 3 article reviews
lei lu - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Estrogenic activity of E2-conjugated GLP-1 is mediated by intracellular endolysosomal acidification and estrone metabolism Article Snippet: NES-Nluc-miniG plasmids (mGα s and mGα q ) were gifts from Kevin Pfleger (Harry Perkins Institute of Medical Research, Nedlands, WA, Australia) as originally published by Professor Nevin Lambert (Augusta University, Augusta, GA, USA) [ ]. β-arrestin 1/2-Rluc8 plasmids were a gift from Professor Terry Hébert (McGill University, Montreal, Canada). .. EGFP-CAAX was a gift from Article Title: Inhibition of PolyGA Dipeptide Repeat Protein Aggregation by Nucleic Acid Aptamers in C9 Amyotrophic Lateral Sclerosis-Frontotemporal Dementia Models. Article Snippet: Hexanucleotide (GGG GCC ) repeat expansion in non-coding region of C9ORF72 is the main genetic cause of amyotrophic lateral sclerosis-frontotemporal dementia (ALS-FTD).. Gain of toxic function, via RNA or proteins, or loss of function via haploinsufficiency, are probable mechanisms of disease progression.. Expanded GGG GCC repeat codes for dipeptide repeat (DPR) proteins which form inclusions in the brain. Article Title: SYNGAP1 deficiency disrupts synaptic neoteny in xenotransplanted human cortical neurons in vivo Article Snippet: .. The T2A-tCD8 fragment was amplified from CD8a-EGFP was a gift from Article Title: SYNGAP1 deficiency disrupts synaptic neoteny in xenotransplanted human cortical neurons in vivo. Article Snippet: The T2A-tCD8 fragment was amplified from CD8a-EGFP was a gift from Lei Lu (Addgene plasmid # 86051; http://n2t.net/addgene:86051; RRID:Addgene_86051) using following primers pair: 50- tTGTACAAGGGATCCGGA GAGGGGAGAGGATCACTGCTGACTTGCGGGGATGTGGAAGAGAACCCAGGGCCCATGGCCTTACCAGTGACC-3’/50- aAGCGCT TCAGTGGTTGCAGTAAAGGGTGATAACCAGTGACAGGAGAAGG-3’. .. The T2A-tCD8 fragment was amplified from CD8a-EGFP was a gift from Article Title: Development of a highly sensitive platform for protein-protein interaction detection and regulation of T cell function. Article Snippet: .. We thank Mien- Chie Hung for providing the HER2 WT plasmid (Addgene #16257), Feng Zhang for providing the lentiCRISPR v2 plasmid (Addgene #52961), Ronald D. Vale for providing the TCRα/β/CD3ε/ζ plasmid (Addgene #89347), Article Title: Estrogenic activity of E2-conjugated GLP-1 is mediated by intracellular endolysosomal acidification and estrone metabolism. Article Snippet: NES-Nluc-miniG plasmids (mGαs and mGαq) 437 were gifts from Kevin Pfleger (Harry Perkins Institute of Medical Research, Nedlands, WA, 438 Australia) as originally published by Professor Nevin Lambert (Augusta University, Augusta, GA, 439 USA) [36]. β-arrestin 1/2-Rluc8 plasmids were a gift from Professor Terry Hébert (McGill 440 University, Montreal, Canada). .. EGFP-CAAX was a gift from Article Title: Movement of the endoplasmic reticulum is driven by multiple classes of vesicles marked by Rab-GTPases Article Snippet: Rapalog A/C heterodimerizer (Takara, Cat # 635056) was added at 5 μM final concentration. mCherry-ER-3 (mCherry-KDEL; Addgene plasmid #55041) and mEmerald- TGNP-N-10 (Addgene plasmid #54279) were gifts from Michael Davidson. mCherrySec61-β was a gift from Gia Voeltz (Zurek et al., 2011; Addgene plasmid #49155). mEmerald-Sec61β-C1 was a gift from Jennifer Lippincott-Schwartz (Nixon-Abell et al., 2016; Addgen plasmid #90992). .. The following eGFP-Rab plasmids were gifts from Marci Scidmore: eGFP-Rab6a (Rzomp et al., 2003; Addgene plasmid #49469), eGFPRab6a Q72L (Moorhead et al., 2007; Addgene plasmid #49483), eGFP-Rab6a T27N (Moorhead et al., 2007; Addgene plasmid #49484), eGFP-Rab6b (Rzomp et al., 2003; 49470), eGFP-Rab6b Q72L (Addgene plasmid #49889), eGFP-Rab6b T27N (Addgene plasmid # 49890), eGFP-Rab10 (Rzomp et al., 2003; Addgene plasmid #49472), eGFPRab10 Q68L (Huang et al., 2010; Addgene plasmid #49544), eGFP-Rab8 (Huang et al., 2010; Addgene plasmid #49543), eGFP-Rab8 T22N (Addgene plasmid #49893), eGFPRab13 (Huang et al., 2010; Addgene plasmid #49548), eGFP-Rab14 (Huang et al., 2010; Addgene plasmid #49549), and eGFP-Rab14 S25N (Addgene plasmid #49593). eGFP-Rab8 Q67L was a gift from Article Title: Movement of the endoplasmic reticulum is driven by multiple classes of vesicles marked by Rab-GTPases Article Snippet: To visualize mitochondria, 0.2 μl of 1mM Mito-tracker Deep Red was added 60 mins prior to imaging. mCherry-ER-3 (mCherry-KDEL; Addgene plasmid #55041) and mEmerald-TGNP-N-10 (Addgene plasmid #54279) were gifts from Michael Davidson. mCherry-Sec61-β was a gift from Gia Voeltz ( Zurek et al ., 2011 ; Addgene plasmid #49155). mEmerald-Sec61β-C1 was a gift from Jennifer Lippincott-Schwartz ( Nixon-Abell et al ., 2016 ; Addgene plasmid #90992). .. The following eGFP-Rab plasmids were gifts from Marci Scidmore: eGFP-Rab6a ( Rzomp et al ., 2003 ; Addgene plasmid #49469), eGFP-Rab6a Q72L ( Moorhead et al ., 2007 ; Addgene plasmid #49483), eGFP-Rab6a T27N ( Moorhead et al ., 2007 ; Addgene plasmid #49484), eGFP-Rab6b (Rzomp et al., 2003( Rzomp et al ., 2003 ; Addgene plasmid #49470), eGFP-Rab6b Q72L (Addgene plasmid #49889), eGFP-Rab6b T27N (Addgene plasmid # 49890), eGFP-Rab10 ( Rzomp et al ., 2003 ; Addgene plasmid #49472), eGFP-Rab10 Q68L ( Huang et al ., 2010 ; Addgene plasmid #49544), eGFP-Rab8 ( Huang et al ., 2010 ; Addgene plasmid #49543), eGFP-Rab8 T22N (Addgene plasmid #49893), eGFP-Rab13 (( Huang et al ., 2010 ; Addgene plasmid #49548), eGFP-Rab14 ( Huang et al ., 2010 ; Addgene plasmid #49549), and eGFP-Rab14 S25N (Addgene plasmid #49593). eGFP-Rab8 Q67L was a gift from Amplification:Article Title: SYNGAP1 deficiency disrupts synaptic neoteny in xenotransplanted human cortical neurons in vivo Article Snippet: .. The T2A-tCD8 fragment was amplified from CD8a-EGFP was a gift from Article Title: SYNGAP1 deficiency disrupts synaptic neoteny in xenotransplanted human cortical neurons in vivo. Article Snippet: The T2A-tCD8 fragment was amplified from CD8a-EGFP was a gift from Lei Lu (Addgene plasmid # 86051; http://n2t.net/addgene:86051; RRID:Addgene_86051) using following primers pair: 50- tTGTACAAGGGATCCGGA GAGGGGAGAGGATCACTGCTGACTTGCGGGGATGTGGAAGAGAACCCAGGGCCCATGGCCTTACCAGTGACC-3’/50- aAGCGCT TCAGTGGTTGCAGTAAAGGGTGATAACCAGTGACAGGAGAAGG-3’. .. The T2A-tCD8 fragment was amplified from CD8a-EGFP was a gift from |